Ternyata air bisa mendengar …Subhanallah

Dan Kami ciptakan dari air segala sesuatu yang hidup.”
(Q.S. Al Anbiya:30)

Dalam kitab-kitab tafsir klasik, ayat tadi diartikan bahwa tanpa air semua akan mati kehausan. Tetapi di Jepang, Dr. Masaru Emoto dari Universitas Yokohama dengan tekun melakukan penelitian tentang perilaku air. Air murni dari mata air di Pulau Honshu didoakan secara agama Shinto, lalu didinginkan sampai -5oC di laboratorium, lantas difoto dengan mikroskop elektron dengan kamera kecepatan tinggi. Ternyata molekul air membentuk kristal segi enam yang indah. Percobaan diulangi dengan membacakan kata, “Arigato (terima kasih dalam bahasa Jepang)” di depan botol air tadi. Kristal kembali membentuk sangat indah. Lalu dicoba dengan menghadapkan tulisan huruf Jepang, “Arigato”. Kristal membentuk dengan keindahan yang sama. Selanjutnya ditunjukkan kata “setan”, kristal berbentuk buruk. Diputarkan musik Symphony Mozart, kristal muncul berbentuk bunga. Ketika musik heavy metal diperdengarkan, kristal hancur.

Ketika 500 orang berkonsentrasi memusatkan pesan “peace” di depan sebotol air, kristal air tadi mengembang bercabang-cabang dengan indahnya. Dan ketika dicoba dibacakan doa Islam, kristal bersegi enam dengan lima cabang daun muncul berkilauan. Subhanallah. Dr. Emoto akhirnya berkeliling dunia melakukan percobaan dengan air di Swiss, Berlin, Prancis, Palestina, dan ia kemudian diundang ke Markas Besar PBB di New York untuk mempresentasikan temuannya pada bulan Maret 2005 lalu. Ternyata air bisa “mendengar” kata-kata, bisa “membaca” tulisan, dan bisa “mengerti” pesan. Dalam bukunya The Hidden Message in Water, Dr. Masaru Emoto menguraikan bahwa air bersifat bisa merekam pesan, seperti pita magnetik atau compact disk. Semakin kuat konsentrasi pemberi pesan, semakin dalam pesan tercetak di air. Air bisa mentransfer pesan tadi melalui molekul air yang lain. Barangkali temuan ini bisa menjelaskan, kenapa air putih yang didoakan bisa menyembuhkan si sakit. Dulu ini kita anggap musyrik, atau paling sedikit kita anggap sekadar sugesti, tetapi ternyata molekul air itu menangkap pesan doa kesembuhan, menyimpannya, lalu vibrasinya merambat kepada molekul air lain yang ada di tubuh si sakit. Tubuh manusia memang 75% terdiri atas air. Otak 74,5% air. Darah 82% air. Tulang yang keras pun mengandung 22% air. Air putih galon di rumah, bisa setiap hari didoakan dengan khusyu kepada Allah, agar anak yang meminumnya saleh, sehat, dan cerdas, dan agar suami yang meminum tetap setia. Air tadi akan berproses di tubuh meneruskan pesan kepada air di otak dan pembuluh darah. Dengan izin Allah, pesan tadi akan dilaksanakan tubuh tanpa kita sadari. Bila air minum di suatu kota didoakan dengan serius untuk kesalehan, insya Allah semua penduduk yang meminumnya akan menjadi baik dan tidak beringas. Rasulullah saw. bersabda, “Zamzam lima syuriba lahu”, “Air zamzam akan melaksanakan pesan dan niat yang meminumnya”. Barangsiapa minum supaya kenyang, dia akan kenyang. Barangsiapa minum untuk menyembuhkan sakit, dia akan sembuh. Subhanallah . Pantaslah air zamzam begitu berkhasiat karena dia menyimpan pesan doa jutaan manusia selama ribuan tahun sejak Nabi Ibrahim a.s.

Bila kita renungkan berpuluh ayat Al Quran tentang air, kita akan tersentak bahwa Allah rupanya selalu menarik perhatian kita kepada air. Bahwa air tidak sekadar benda mati. Dia menyimpan kekuatan, daya rekam, daya penyembuh, dan sifat-sifat aneh lagi yang menunggu disingkap manusia. Islam adalah agama yang paling melekat dengan air. Shalat wajib perlu air wudlu 5 kali sehari. Habis bercampur, suami istri wajib mandi. Mati pun wajib dimandikan. Tidak ada agama lain yang menyuruh memandikan jenazah, malahan ada yang dibakar. Tetapi kita belum melakukan zikir air. Kita masih perlakukan air tanpa respek. Kita buang secara mubazir, bahkan kita cemari. Astaghfirullah.

Seorang ilmuwan Jepang telah merintis. Ilmuwan muslim harus melanjutkan kajian kehidupan ini berdasarkan Al Quran dan hadis.

Wallahu a’lam ..

Apa itu Penyakit FLU SINGAPURA?

“Flu Singapura” sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/?biasa? pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ).
Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.

GAMBARAN KLINIK :

Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :

o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.

Komplikasi penyakit ini adalah :

o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (?Polio-like illness? )

Satu kelompok dengan penyakit ini adalah :

1. Vesicular stomatitis dengan exanthem (KTM) – Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) – EV 70
3. Acute Lymphonodular Pharyngitis – Cox A 10

LABORATORIUM :

Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.

Diagnosa Laboratorium adalah sebagai berikut :

1. Deteksi Virus :

o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.

2. Deteksi RNA :

RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)

3. Serodiagnosis :

Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

TATALAKSANA :

o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :

Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

Extracorporeal membrane oxygenation.

o Pengobatan simptomatik :
Antiseptik didaerah mulut
Analgesik misal parasetamol
Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases? ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.

PENCEGAHAN DAN PENGENDALIAN PENYAKIT:
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan ?Overcrowding?, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ? Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan ?Universal Precaution?nya.

Hand-Foot-Mouth Disease (HFMD)

Etiologi : Coxsackievirus A 16
Cara Penularan : Droplets
Masa Inkubasi : 4 ? 6 Hari

Manifestasi Klinis :
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1 ? 2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada HFMD. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadibula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas.

Diagnosis :
Manifestasi klinis dan isolasi virus dengan preparat Tzank.

Diagnosis Banding : Varisela, herpes

Terapi : Simptomatis

“Flu Singapura” sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/?biasa? pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.

GAMBARAN KLINIK :
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :

o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.

Komplikasi penyakit ini adalah :

o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (?Polio-like illness? )

Satu kelompok dengan penyakit ini adalah :

1. Vesicular stomatitis dengan exanthem (KTM) – Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) – EV 70
3. Acute Lymphonodular Pharyngitis – Cox A 10

LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.
Diagnosa Laboratorium adalah sebagai berikut :
1. Deteksi Virus :
o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.
2. Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)
3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

TATALAKSANA :
o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :
Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

Extracorporeal membrane oxygenation.

o Pengobatan simptomatik :
Antiseptik didaerah mulut Analgesik misal parasetamol Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases? ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.

PENCEGAHAN DAN PENGENDALIAN PENYAKIT:

Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan ?Overcrowding?, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ? Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan ?Universal Precaution?nya.

Hand-Foot-Mouth Disease (HFMD)
Etiologi : Coxsackievirus A 16
Cara Penularan : Droplets
Masa Inkubasi : 4 ? 6 Hari

Manifestasi Klinis :
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1 ? 2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada HFMD. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadibula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas.

Diagnosis :
Manifestasi klinis dan isolasi virus dengan preparat Tzank.
Diagnosis Banding : Varisela, herpes
Terapi : Simptomatis

faktor penyebab MIGREN


dr. Yuda Turana

Migren merupakan nyeri kepala yang hilang timbul, biasanya hanya pada sebelah kepala, berdenyut, serangan berakhir dalam waktu 4 – 72 jam, disertai gejala mual/muntah dan dapat didahului oleh gejala aura.

Meskipun masih menjadi misteri bagaimana mekanisme pasti saat serangan migren. Namun kelihatannya masalah berawal dari respon tubuh terhadap stress. Tubuh berfikir bahwa dapat mengatasi stress dengan menyiapkan otot untuk melakukan aksi ; tubuh meningkatkan aliran darah ke otot dan mengurangi aliran darah ke otak. Kemudian saat ancaman terhadap tubuh sudah hilang, pembuluh darah otak terbuka kembali yang menyebabkan aliran darah menyerbu kembali dan inilah yang menyebabkan serangan nyeri pada migren.

MENCARI FAKTOR PENYEBAB

Bagi pasien dengan migren yang menahun, sering berulang, sebaiknya mencari faktor pencetus serangan. Beberapa faktor yang dapat mencetuskan migren adalah : kurangnya jam tidur, terlalu banyak tidur ( di akhir pekan saat anda libur tidak bekerja ), saat menstruasi, adanya cahaya yang berlebih, suara yang terlalu bising, dan hipoglikemia ( misalnya : saat anda telat makan ). Beberapa obat dapat pula mencetuskan serangan migren ini seperti : nitrat, klorokuin, obat kontrasepsi, indometasin , Alkohol dan makanan tertentu yang mengandung tyramine, nitrate , monosodium glutamat , dsb . Contoh makanan yang mengandung vasoactive amines ( tyramine dan b-phenylethylamines ) adalah : keju, coklat, kacang-kacangan, jeruk sitrus, bawang merah. Contoh makanan yang mengandung nitrat : daging ham, saus, hot dog, daging. Contoh makanan yang mengandung monosodium glutamat : makanan dengan penyedap/ vetsin yang banyak misalnya pada masakan cina, saus, beberapa makanan kaleng. Contoh makanan yang lain adalah : alkohol, telur, yoghurt, makanan kering.

Stress emosional merupakan juga salah satu pencetus serangan migrain. Sehingga penting juga mengubah pikiran dan sikap yang negatif.

BAGAIMANA MENGATASI MIGREN ?

Jika anda penderita nyeri migren yang menahun. Sebaiknya anda membuat suatu catatan harian mengenai serangan migren. Catatan harian tersebut berisi saat-saat anda mengalami serangan migren. Catatlah apa saja yang anda makan selama 24 jam terakhir. Catat pula faktor emosi yang menyebabkan serangan itu. Kemudian evaluasilah setiap saat pencetus serangan migren anda. Bila anda mencurigai makanan tertentu , maka cobalah makanan tersebut 1 atau 2 kali lagi pada saat yang lain , jika memang betul menyebabkan serangan migren maka anda harus menghindari makanan tersebut. Sebaiknya pula hindari minuman yang mengandung banyak cafein ( kopi ) dan gunakan kacamata gelap saat siang hari.

Tidurlah yang cukup. Tidak kurang dan tidak berlebih. Bila pada akhir pekan anda akan tidur lama, maka tetaplah bangun dahulu pada jam rutin anda bangun. Setelah itu tidak masalah jika anda tidur kembali. Hindari stress yang berlebih , berolahraga rutin dan latihlah beberapa teknik relaksasi. Andapun dapat menekan beberapa titik acupoints untuk membantu penyembuhan.

Melihat bahwa gejala migren berasal dari penyempitan/ kontriksi pembuluh darah di otak ; jelaslah bahwa efektifitas pengobatan harus menggunakan metode yang dapat melebarkan pembuluh darah tersebut. Jadi jika anda akan menghentikan gejala migren, anda harus mencegah pembuluh darah ini berkonstriksi ( menyempit ). Pada saat serangan migren, perhatikan bahwa penderita juga mengalami tangan dan kaki yang dingin. Dari sini bisa dilihat bahwa pada saat pembuluh darah di otak berkonstriksi akibat respon tubuh terhadap stress maka pembuluh darah yang menuju ke tangan dan kaki juga berkonstriksi. Jadi kemampuan anda untuk membuka aliran darah di tangan dan kaki maka akan membuka juga aliran darah ke otak. Sehingga anda akan terhindar dari serangan migren. Jika baru saja ada tanda-tanda akan terjadi serangan migren maka dapat dilakukan teknik berikut ini :

1. Rilekskan diri anda secara fisik dan mental ( anda dapat menggunakan metode relaksasi dalam buku ini ).

2. Cobalah untuk melihat tangan anda yang pucat. Bayangkan aliran darah semakin melebar dan melebar. Lihatlah semakin banyak aliran darah mengalir ke kulit anda. Jika anda kesulitan dengan teknik ini, maka bisa dibayangkan juga tangan anda di depan tungku api dan tangan terasa hangat.

3. Bayangkan tangan anda semakin bertambah hangat. Saat ini terjadi maka aliran darah di otakpun meningkat dan anda tidak mengalami serangan migren.

PENGOBATAN NYERI LEHER AKUT DAN KRONIK


dr. Yuda Turana

Konsep pengobatan nyeri leher akut dan kronik pada dasarnya adalah sama, yaitu mencegah agar tidak berlanjut dan tidak menyebabkan kecacatan. Pada saat anda menderita nyeri leher akut dapat dicoba dulu teknik strain-counterstrain bila tidak ada perbaikan konsultasikan dengan dokter anda . Pastikan tidak ada sesuatu yang dapat membahayakan anda seperti fraktur dan dislokasi. Dokter anda biasanya akan memasang kolar di leher anda untuk membatasi gerak. Pemakaian kolar ini harus sesuai untuk tiap-tiap pasien. Penggunaan kolar ini biasanya 10 – 14 hari. Bila dipakai melebihi 2 minggu dapat terjadi pengecilan dari otot-otot leher .  Pada fase akut ini jangan dilakukan latihan fleksi dan ekstensi. Dapat pula digunakan bantal es di belakang leher selama 15 – 20 menit. Ini mempunyai khasiat sebagai analgetika dan relaksan. Dapat pula dilakukan masase untuk mengurangi cairan yang berkumpul di sekitar cedera.

LATIHAN LEHER

Ada beberapa latihan yang digunakan untuk memperkuat otot-otot leher seperti : latihan gerak sendi dan latihan isometrik.

Latihan gerak sendi

1. Putar  kepala ke samping kanan sampai terasa nyeri, berhenti dan kembali ke tengah. Ulangi lagi ke arah lain.
2. Tundukkan kepala ke bawah mendekati dada , berhenti, kemudian kembali tegak.
3. Miringkan kepala ke kanan, berhenti, kemudian kembali ke tengah. Ulangi ke arah lain.
4. Mirirngkan kepala ke belakang sehingga terlihat langit, berhenti, kembalikan lagi ke posisi tegak.

LATIHAN ISOMETRIK

1. Tekan kepala ke depan pada telapak tangan dan tahan selama tiga hitungan.
2. Tekan kepala ke samping dengan telapak tangan. Usahakan mendekatkan telinga ke bahu dan tahan selama tiga hitungan.
3. Tekan kepala  dari belakang dengan kedua tangan. Usahakan mendorong kepala ke belakang dan tahan selama tiga detik.
4. Tekan kepala di samping dahi. Usahakan memutar dagu mendekati bahu dan tahan selama tiga hitungan.

Metode Mc Kenzie pada nyeri leher

Latihan ini diberikan pada nyeri tengkuk lokal tanpa disertai gangguan saraf maupun tulang setelah dipastikan oleh dokter anda.

1. Penderita duduk di atas kursi. Lakukan retraksi kepala, yaitu menarik kepala ke belakang . Jadi dalam posisi duduk , pandangan mata lurus ke depan , tarik kepala ke belakang  ( kepala tetap tegak ). Lakukan latihan ini sampai 10 kali tiap latihan. Setiap retraksi ditahan 5 hitungan.

2. Penderita duduk di atas kursi. Latihan kedua ini mengikuti latihan pertama dan kepala dalam posisi retraksi kemudian dagu diangkat, mata melihat langit-langit. Sewaktu kepala dalam posisi tersebut, putarlah ke kanan dan ke kiri kemudian kembali pada posisi awal. Ulangi latihan  ini 10 kali setiap kali latihan.

3. Retraksi kepala , namun dalam posisi berbaring tanpa bantal. Latihan ini prinsipnya sama dengan latihan pertama, tetapi dalam posisi berbaring. Mula-mula tekankan kepala ke alas kuat-kuat  pada waktu itu tariklah dagu ke tubuh, pandangan tetap ke atas dan tahan sampai hitungan ke lima kemudian lemaskan. Latihan ini di ulang sampai 10 kali setiap pengobatan. Latihan ini bisa digunakan untuk nyeri tengkk yang hebat bila latihan dalam posisi duduk kurang tahan dilakukan.

4. Dalam posisi berbaring, kepala di luar tempat tidur dan disangga oleh tangan kanan.
Tangan kanan yang menyangga kepala pelan-pelan dilepaskan hingga kepala ekstensi ke bawah. Secara aktif kepala di ekstensikan lagi hingga maksimal. Waktu posisi ekstensi penuh ini kepala dirotasikan ke kanan dan ke kiri. Tangan kanan kembali menyangga lagi ke bawah kepala dan geserkan badan hingga kepala tersangga penuh kembali di atas tempat tidur. Latihan ini dilakukan sekali saja setiap latihan.

5. Lakukan seperti latihan nomor satu kemudian tekuklah kepala ke kanan kemudian  ke kiri. Lakukan gerakan sebanyak 10 kali.

6. Lakukan seperti latihan nomor satu kemudian putarlah kepala ke arah kanan kemudian ke kiri. Lakukan gerakan sebanyak 10 kali. Dapat dibantu tahanan oleh tangan pada saat kepala di putar.

7. Dalam posisi duduk di kursi . pandangan lrus ke depan dan rileks. Jatuhkan kepala ke depan hingga hampir menyentuh dada secara lemas. Kemudian taruh kedua tangan di bagian belakang kepala ( jari-jari saling menjepit ). Jatuhkan siku dengan rileks ke bawah sehingga beban kedua tangan menambah beban leher. Tahan selama 5 hitungan dan kembali pada posisi awal. Latihan bisa diulangi 2 sampai 3 kali.

Jika terasa nyeri leher akut dapat dicoba latihan 1 dan 2   atau 3 dan 4.  Dan bila nyerinya sudah berkurang dapat dilakukan  latihan 6 dan 7 kemudian latihan 1 dan 2. Jika timbul nyeri di salah satu sisi  leher , lakukan latihan 5 kemudian diikuti latihan 1 dan 2.

SETIAP SAAT, SADAR TERHADAP SIKAP YANG BENAR DALAM KEADAAN POSISI APAPUN, KEMUDIAN PELIHARALAH SIKAP YANG BENAR INI SECARA TERUS MENERUS.

Setiap latihan yang meningkatkan denyut jantung dan pernafasan akan memperkuat tulang belakang , otot leher dan bahu. Berjalan adalah latihan yang paling aman untuk orang tua. Berjalanlah dengan tegak satu jam sehari, tiga sampai lima hari dalam seminggu.

COPOT KACA MATA ANDA!!


dr. Yuda Turana

Sudah lama dipercaya bahwa semakin usia tua fungsi penglihatan menurun dan proses itu sulit untuk dihindari. Para naturopath menganjurkan untuk diet yang baik dan latihan otot-otot mata untuk meningkatkan fungsi penglihatan.

William H Bates adalah dokter mata dan dosen di New York Postgraduated Medical School yang pada tahun 1919 menerbitkan buku : Better Eyesight Without Glasses yang berisi latihan-latihan untuk meningkatkan fungsi penglihatan . Dia berprinsip kaca mata adalah tidak mengobati penyebab dari menurunnya fungsi penglihatan . Dalam buku alternatif latihan tersebut sering disebut  metode Bates. Berikut latihan yang dapat anda lakukan untuk meningkatkan fungsi penglihatan anda :

1. PALMING

Pejamkan mata anda dan tutup dengan kedua telapak tangan . Pastikan tidak menyentuh mata. Lalu pikirkan sesuatu yangmenyenangkan atau dengarkan musik. Jangan kosongkan pikiran anda karena dapat mengakibatkan mata anda tidak rileks

Lakukan 2 – 3 kali sehari masing-masing selama 10 menit.

2. SPLASHING

Siramlah mata anda yang terpejam dengan air hangat 20 kali kemudian 20 kali dengan air dingin. Ulangi hal ini sore hari namun lakukan dahulu dengan air dingin kemudian hangat.

3. NEAR AND FAR FOCUSING

Peganglah pensil di depan mata anda kurang lebih 15 cm dari hidung. Dan pensil yang lain sejajar namun dalam posisi yang lebih jauh, sejauh tangan anda dalam posisi lurus. Fokuskan penglihatan mata anda pada pensil yang satu kediplah kemudian fokuskan pada pensil yang lain. Perhatikan bahwa anda hanya fokus pada satu pensil secara bergantian namun anda tidak melihat double.

4. SWINGING

Berdiri didepan jendela dengan kaki agak sedikit berjauhan kemudian latihlah mata anda untuk melihat ke kanan dan ke kiri pada objek di luar jendela. Kediplah saat pindah gerakan dari tiap sisi. Perhatikan seolah-olah jendela berpindah pada arah berlawanan dari diri anda.

5. SHIFTING

Saat anda melihat suatu objek. Pusatkan perhatian anda pada objek tersebut. Kemudian lihatlah batas atas dan bawah objek. Kemudian batas kiri dan kanan objek. Kemudian Batas objek tersebut anda perkecil dan lihatlah batas objek atas bawah, kanan kiri. Semakin kecil batas objek maka semakin maka semakin terlatih otot mata anda.

Latihan  dapat anda lakukan secara teratur  2-3 kali sehari.

( Catatan : Metode Bates ini hanya pada gangguan penglihatan akibat refraksi dan bukan karena katarak maupun glaukoma , konsultasikan dengan dokter anda )

Bahan Bacaan :

1. Inglis B, West R. . The Alternative Health Guide
2. Coleman V. Body Power
3. Shealy CN. Alternative Healing Therapies

KURANGI KAFEIN ANDA !!


dr. Yuda Turana

Cobalah menghindari minum terlalu banyak kafein. Di dunia dalam setahun konsumsi kopi mungkin merupakan sumber utama dari kafein- sekitar 5 juta ton.  Kafein ini bersifat adiktif dan potensial stimulan yang akan menyebabkan nyeri anda bertambah berat.

EFEK DARI KAFEIN

  1. Menstimulasi otak dan susunan saraf yang lain
  2. Meningkatkan asam lambung
  3. Detak jantung menjadi cepat dan tekanan darah naik.
  4. Terlalu banyak kafein menyebabkan otot anda menjadi tremor, sulit tidur, cemas, depresi, sakit kepala, gangguan pencernaan, jantung berdebar, perubahan kepribadian.

REKOMENDASI INTAKE HARIAN

Intake harian untuk orang dewasa sebaiknya tidak melebihi 250 mg, dan untuk anak tidak lebih dari 125 mg. Secangkir kopi berisi 100 sampai 150 mg kafein.  Secangkir instan kopi berisi 75 mg sampai 100 mg kafein. Secangkir teh mengandung antara 50 sampai 100 mg kafein. Satu cangkir kecil coklat menghasilkan 50 mg kalori. Minuman Cola mengandung 50 mg kafein.

NYERI BADAN , APAKAH KARENA ASAM URAT ?


dr. Yuda Turana

Tidak semua gejala nyeri di badan/ sendi akibat dari asam urat.  Rematik sendiri ada banyak jenisnya dan yang murni karena asam urat hanya 1 yaitu : Artritis Gout. Jadi tidak semua penyakit rematik harus berdiet ria.  Secara umum diet pada penderita rematik bertujuan menurunkan  berat badan sehingga beban pada persendian kaki berkurang dengan harapan nyeri sendi lutut dan kaki pun hilang.

Tanda-tanda rematik karena asam urat adalah :

  1. Nyeri biasanya terjadi tiba-tiba pada satu sendi  ( pada 3 – 14 % bisa juga pada banyak sendi ). Urutan sendi yang biasanya terkena : Ibu jari kaki, sendi telapak kaki, pergelangan kaki, sendi kaki  belakang, pergelangan tangan, dan lutut. Sendi yang terkena biasanya panas, bengkak, merah, sakit saat digerakkan. Kalau sudah agak lama ( hari ke 5 )  kulit di atasnya biasanya berwarna merah kusam .

  2. Bisa juga ditemui adanya thopi  ( sejenis benjolan ) di telinga, maupun di sendi.

  3. Bila dilakukan pemeriksaan darah asam urat dapat normal maupun meninggi.

Bila anda mempunyai gejala-gejala di atas maka barulah anda kemungkinan besar menderita rematik karena asam urat.